StudentShare
Contact Us
Sign In / Sign Up for FREE
Search
Go to advanced search...
Free

DNA Barcoding Invertebrate #1 - Lab Report Example

Cite this document
Summary
Sequences that are used as barcodes are usually those that are unique and conserved within a species. In DNA barcoding, usually a…
Download full paper File format: .doc, available for editing
GRAB THE BEST PAPER96.7% of users find it useful
DNA Barcoding Invertebrate Lab Report #1
Read Text Preview

Extract of sample "DNA Barcoding Invertebrate #1"

Biology Topic: lab report on DNA barcoding Introduction: DNA barcoding provides a versatile tool for ification of organism based on DNA taxonomy and delimitation and ‘discovery’ of new species. Sequences that are used as barcodes are usually those that are unique and conserved within a species. In DNA barcoding, usually a four staged approache is engaged. The first stage is to obtain a specimen which may be from from tissue or culture collections. In the second stage, laboratory analysis which involves extraction of genetic material to obtain DNA batcode sequence is done.

These sequences are later placed in a barcode database such as the Barcode intiative to be used as species identifiers to assign unknown specimens to known species. Currently two such databases exists, the Barcode of life (BOLD) and The International Nucleotide Sequence Database Collaborative which is an intiative of the three main Nucleotide databases, GenBank, EMBL and DDBJ. The fouth and final stage is to carry out an analysis where specimens are identified with the closest matching reference record in the aforementioned databases.

In this lab report, we sought to perform a barcode analysis using mayfly DNA sequences in the BOLD database. The barcode sequence is mainly a short DNA sequence which has a uniform location in the genome and is used to identify species. One of the commonly used sequence in DNA barcoding is the cytochrome oxidase subunit 1 (COI). This was the sequence we used this work. The barcoding process involves identifying a universal locus which has retained enough sequence conservation throughout evolution and can be sourced from many organisms.

This sequence should also be diverse so as to be competent enough to differentiate a target species to the family level. Generally regions of the chloroplast (rbcL gene) and the mitochondria (COI) meet these requirements. Various studies have been undertaken by Herbert et al (2003a, 2004b) and established this COI sequence as the sequence of choice in DNA barcoding in insects and vertebrates. Inverterbrates such as mayfly are collected whole and may be euthanized in a kill jar by placing them in a freezer.

In the lab, primers are designed to target the conserved regions flanking the rbcL or the COI regions.Examples of the barcoding primers which may be used in insects5-GTAAAACGACGGCCAGTATTCAACCAATCATAAAGATATTGG-3 (forward primer - LepF1_t1)5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAAAGACATTGG-3 (forward primer - VF1_t1)5-TGTAAAACGACGGCCAGTTCTCAACCAACCACAARGAYATYGG-3 (forward primer - VF1d_t1)5-TGTAAAACGACGGCCAGTTCTCAACCAACCAIAAIGAIATIGG-3 (forward primer - VF1i_t1)5-CAGGAAACAGCTATGACTAAACTTCTGGATGTCCAAAAAATCA-3 (reverse primer - LepR1_t1)5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCRAARAAYCA-3 (reverse primer - VR1d_t1)5-CAGGAAACAGCTATGACTAGACTTCTGGGTGGCCAAAGAATCA-3 (reverse primer - VR1_t1)5-CAGGAAACAGCTATGACTAGACTTCTGGGTGICCIAAIAAICA-3 (reverse primer - VR1i_t1)These primers should be able to accommodate degeneracy occurring in the conserved regions as a result of evolutionary processes such as the ‘genetic drift’.

Results:BLAST results:FASTA format for the top 2 matchesSequence JF287131.1:>gi|325653673|gb|JF287131.1| Ephemerella subvaria voucher 08-SWRC-0922 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrialACTTTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTGGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGGTTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGAGCTGTGAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTTSequence two JF287129.

1;>gi|325653669|gb|JF287129.1| Ephemerella subvaria voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrialACTCTATACTTTATTTTCGGGGCTTGATCCGGCATAATTGGCACCTCTTTAAGTCTACTCATTCGGGCCGAACTAGGGCAACCTGGGTCCCTGATTGGAGATGACCAAATTTACAATGTCATCGTTACCGCCCATGCCTTCATTATAATTTTCTTTATAGTAATGCCTATTATAATTGGAGGATTTGGGAATTGATTAGTGCCCCTCATACTCGGAGCTCCCGATATAGCTTTCCCCCGCATAAATAATATAAGCTTTTGACTTTTGCCTCCTGCCTTAACACTCCTATTAGCCAGTAGCATGGTAGAAAGAGGGGCGGGTACTGGTTGAACAGTTTACCCACCCCTGGCTTCCGGTATTGCTCATGCTGGAGGCTCTGTAGATCTCGCCATTTTCTCTCTTCACTTGGCTGGAGTCTCCTCTATTCTAGGGGCTGTAAACTTTATTACAACAACTATTAATATGCGGGCAAGAGGTATATCTATAGACCGGATTCCCCTTTTCGTATGATCTGTCCTAATTACAGCTATCTTACTTTTACTTTCTCTCCCAGTTTTAGCAGGAGCCATCACGATACTCCTCACTGACCGGAACCTTAATACATCCTTCTTTGACCCTGCTGGGGGAGGAGACCCCATTCTTTACCAGCATTTATTTThe top two matches in the BLAST databaseAccession number sequences name E value query coverage1. JF287129.1 Ephemerella subvaria 0.

0 100% voucher 08-SWRC-0728 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial2. JF287129.1 Ephemerella subvaria voucher 08-SWRC-0728 0.0 100% cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrialThe top two mathces in the BOLD databaseTable 1: the first two results of the species level match made by sample #3 in the BOLD databasePhylum classorderFamilyGenusSpeciesSpecimen similarity (%)ArthropodaInsectaephemeropteraEphemerellidaeEphemerellaSubvaria100ArthropodaInsectaephemeropteraEphemerellidaeEphemerellaSubvaria100Discussion:Insects are diverse in nature and present an interesting opportunity for a host of target groups such as taxonomist, conservationists and ecologists.

The coming into place of the DNA technology and its bulging potential has revolutionarized the classification of organisms from the morphological perspective to a more advanced DNA taxonomy which requires DNA barcoding. It provides a novel sytem structured to provide a rapid and accurate species identification by use of short, standardized gene regions as species tag. Mayfly are a common feature in undisturbed freshwater bodies and are utilized by biomonitoring teams in establishing the water quality (Bauernfeind and Moog, 2000).

A match in the taxonomic ID and BOLD ID as evidenced by the BOLD and BLAST results. In some cases matches may fail to occur particularly when the sample is contaminated with DNA from other sources. These contaminants ultimately distort the outcome of the BLAST resulting yielding misleading results. False positives may also occur in queries done in the BOLD database where closely allied congeneric species which have not yet been established in the identification tree may appear in the results thereby resulting to a misleading clasification of the organism of interest.

ReferencesBauernfeind, E. and Moog, O. (2000). Mayflies (Insecta: Ephemeroptera) and the assessment of ecological integrity : a methodological approach. Hydrobiologia 422:71-83Hebert, P. D. N., A. Cywinska, S. L. Ball, and J. R. Dewaard. (2003a). Biological identificationsthrough DNA bar codes. Proceedings of the Royal Society of London B Biological Sciences 270: 313–321.Hebert P.D.N., Stoeckle M.Y, Zemlak T.S., Francis C.M. (2004b). Identification of Birds through DNA Barcodes. PLoS Biol 2: e312.

Read More
Cite this document
  • APA
  • MLA
  • CHICAGO
(“DNA Barcoding Invertebrate Lab Report #1 Example | Topics and Well Written Essays - 500 words”, n.d.)
Retrieved from https://studentshare.org/biology/1591455-dna-barcoding-invertebrate-lab-report-1
(DNA Barcoding Invertebrate Lab Report #1 Example | Topics and Well Written Essays - 500 Words)
https://studentshare.org/biology/1591455-dna-barcoding-invertebrate-lab-report-1.
“DNA Barcoding Invertebrate Lab Report #1 Example | Topics and Well Written Essays - 500 Words”, n.d. https://studentshare.org/biology/1591455-dna-barcoding-invertebrate-lab-report-1.
  • Cited: 0 times

CHECK THESE SAMPLES OF DNA Barcoding Invertebrate Lab Report #1

Lab Report - Precision and Accuracy

(Name) (Professor) (Subject) (Date) Part A: Discussion In Part A, the determiner of precision is the percentage mean deviation, which is 0.... 846%.... Differences in terms of precision, no matter how small, depend on a number of factors.... However, the first human factor is that no two trials are exactly the same, as different sets of hand movements, different directions as well as different forces are used in order to deliver the liquid out of a pipette (“Sources of Error in Pipetting”)....
4 Pages (1000 words) Lab Report

Conservation of momentum. (lab report)

Name Professor Course Date lab Report: Conservation of momentum Abstract The study's intention entailed to ascertain and proof principles of linear conservation of momentum.... Key apparatus used in this experiment included ballistic pendulum and plastic ball besides others that were essential in measuring as well as computing study's obtained quantities....
4 Pages (1000 words) Lab Report

Identification of GMO foods using PCR Lab Report

In the lab, the GMOs presence in conventional soy beans samples was tested by PCR.... This was incubated until the next lab period in the freezer.... In the laboratory, we performed dna isolation on food products (soy beans) and amplification of the dna was done by polymerase chain reaction (PCR) on soy beans food dna in order to detect the presence of genetic modification.... Running head: GMOs Identification of GMOs using PCR College: In the laboratory, we performed dna isolation on food products (soy beans) and amplification of the dna was done by polymerase chain reaction (PCR) on soy beans food dna in order to detect the presence of genetic modification....
3 Pages (750 words) Lab Report

Biological Identifications Through DNA Bar Codes

This paper outlines that dna barcoding is a standardized method of identifying the organism by using small segments of their DNA.... hellip; As the discussion stresses, the quality of the sample DNA dictates the effectiveness of the dna barcoding process.... Essentially it is a dna based identification method which among provides a more advanced species identification as compared to the traditional species identification.... The dna barcode sequences are also rather short in comparison to the entire genome and can be extracted with relative ease utilizing cheap methods....
2 Pages (500 words) Lab Report

Presence or Absence of SNP CU85 in WMIN Gene

The gene has two alleles and so using agarose gel we will be able to detect the bands that match with our reference sample which is Lambda dnadna).... It recognizes rthe double stranded sequence of the dna at AAGCTT and then cleaves after A-1 (Dubey, Hussain & Mittal n.... The working principle in gel electrophoresis involves the movement of the dna sample in the agarose gel.... The difference in the base pairs impact a difference in the molecular weight of the dna and so when the current is introduced at the cathodic end of the electrophoretic chamber the dna will move to the anode with the difference in weight causing the bands to be formed at different locations Francois 2010)....
1 Pages (250 words) Lab Report

Sampling of Terrestrial Invertebrates

In this technique, we collect leaf litter from the ground and place them in plastic bags which are then taken to the lab.... In the lab the litter is placed in specialized Berlese funnel that comes with a mesh lining and the entire set-up is kept under light bulbs that provide warmth and dryness which drives out many of the invertebrates hiding in the litter which is driven to the lower part of the funnel and eventually falls into ethanol.... n our endeavor to sample and study terrestrial invertebrate communities, we used three different sampling techniques for 3 different communities under study....
6 Pages (1500 words) Lab Report

Gene Expression Levels of csy1 Gene

Therefore, for a diploid organism with lab Summary on Gene Expression Levels of csy1 Gene Introduction The science of measuring expression of a gene is a widely practiced technique in molecular biology.... All the DNA bands were made of the same size since the lab samples contained the same DNA sequence.... In this manner, the copy number of the gene stays constant as the dna message is transcribed into a message that is functional as it takes the form of mRNA....
3 Pages (750 words) Lab Report

The Use of the SV Total RNA Isolation System

The requirement for techniques to segregate high-quality RNA swiftly, free of genomic dna infectivity significantly, from small amounts of starting material (i.... To trim down genomic dna to a large extent, which can impede the amplification-based techniques, a DNase treatment step has been added by the system as well.... In this what happens is the insertion of the outside dna into the plant cells/tissues....
9 Pages (2250 words) Lab Report
sponsored ads
We use cookies to create the best experience for you. Keep on browsing if you are OK with that, or find out how to manage cookies.
Contact Us